[26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Haplogroup G ( M201) is a human Y-chromosome haplogroup. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. Int J Legal Med 1997; 110: 134149. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. The L141 mutation involves an insertion.[35]. Am J Hum Genet 2007; 80: 759768. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. The origin of haplogroup G is controversial. volume20,pages 12751282 (2012)Cite this article. [5] Cinnioglu et al. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Hum Genet 2009; 126: 707717. Chromosome Y microsatellites: population genetic and evolutionary aspects. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). [43] L240 was identified in 2009. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. See: Poznik. Genome Res 2008; 18: 830838. PubMed This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. Am J Hum Genet 2006; 78: 202221. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Haplogroup G2a2b is a rare group today in Europe. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. Origin. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). Rosser ZH, Zerjal T, Hurles ME et al. ISSN 1476-5438 (online) Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. There are seeming pockets of unusual concentrations within Europe. Genetic evidence concerning the origins of South and North Ossetians. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. PLoS One 2009; 4: e5792. (Previously the name Haplogroup M was assigned to K2b1d. Kivisild T, Rootsi S, Metspalu M et al. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Summary. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. Am J Hum Genet 2004; 74: 694704. More distantly, G2a3a-M406 occurs in Italy (3%) with a Td of 8100 years ago, consistent with the model of maritime Neolithic colonization of the Italian peninsula from coastal Anatolia and/or the Levant. Eur J Hum Genet 2004; 12: 855863. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Because M201 was identified first, it is the standard SNP test used when testing for G persons. For this are several indications. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. (2000) suggested 17,000 years ago. G2a2b2a is also found in India. Nasidze I, Quinque D, Dupanloup I et al. Hammer MF, Behar DM, Karafet TM et al. Y chromosomal heritage of Croatian population and its island isolates. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. Keller A, Graefen A, Ball M et al. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). [citation needed] It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Haplogroup LT (L298/P326) is also known as Haplogroup K1. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Mitochondrial DNA variation of modern Tuscans supports the near eastern origin of Etruscans. Article Eur J Hum Genet 2007; 15: 485493. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Haplogroup G1 is a primary subclade of haplogroup G . The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Semino et al. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. G1 is possibly believed to have originated in Iran. Parallel evolution of genes and languages in the Caucasus region. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. Marie Lacan, Christine Keyser, Franois-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubzy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Google Scholar. Science 2000; 290: 11551159. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. Haplogroup G represents one of the first peoples in Europe. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. First, we calculated haplogroup diversity using data in Supplementary Table S1 for the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. contracts here. So far all G2a1 persons have a value of 10 at STR marker DYS392. New York: Columbia University Press, 1987. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Network of 248 samples P303 derived from Supplementary Table S3. Haplogroup G was the first branch of Haplogroup F outside of Africa. Nei M : Molecular Evolutionary Genetics. Artefactual values below 0% values were not depicted. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). Excavating Y-chromosome haplotype strata in Anatolia. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Eur J Hum Genet 2009; 17: 820830. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. Am J Hum Genet 2008; 82: 236250. Haplogroup G is a branch on the maternal tree of human kind. Eur J Hum Genet 20, 12751282 (2012). The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Am J Hum Genet 2008; 82: 873882. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Kaniewski D, Van Campo E, Van Lerberghe K et al. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. Balanovsky O, Rootsi S, Pshenichnov A et al. G-M377, now also known as G2b1, has previously been designated G2b and G2c. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. King RJ, DiCristofaro J, Kouvatsi A et al. Internet Explorer). The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . A more compact cluster of Near/Middle Eastern samples is also resolved in the network. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. Nature 2010; 466: 238242. The P303 SNP defines the most frequent and widespread G sub-haplogroup. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. Princeton: Princeton University Press, 1994. Sengupta S, Zhivotovsky LA, King R et al. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. A plot of the sub-clades included in the principal component analysis (Figure 3b) indicates that the clustering of the populations from NW Caucasus is due to their U1* frequency, whereas L497 lineages account for the separation of central Europeans. Pichler I, Fuchsberger C, Platzer C et al. Mol Biol Evol 2011; 28: 29052920. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. ), Ancient G-M201s with sequencing[self-published source?] The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Kayser M, Caglia A, Corach D et al. A separate study on the Argyns found that 71% of males belong to G1. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. Dulik MC, Zhadanov SI, Osipova LP et al. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. Categories have alternating letters and numbers. [2], In 2012, a paper by Siiri Rootsi et al. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. To obtain The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. Vernesi C, Caramelli D, Dupanloup I et al. In the meantime, to ensure continued support, we are displaying the site without styles It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. New insights into the Tyrolean Icemans origin and phenotype as inferred by whole-genome sequencing. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. (2000) suggested 17,000 years ago. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. They are found only in tiny numbers elsewhere. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Its chromosome location listed as 21653414. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). Eur J Hum Genet 2008; 16: 374386. Moreover, these general frequencies mostly consist of two notable lineages. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs.
Ukrainian Festival Nyc 2022,
Articles H